The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Biochim Biophys Acta. 1984 Jul 18;782(3):313-9. doi: 10.1016/0167-4781(84)90067-8.

Abstract

Uniformly 32P-labeled phage-specific tRNAGln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAG psi CGAGAUCAUUGGT psi CAAAUCCAAUAUCCCCUGCCAOH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5'-terminal base and the fifth base from its 3'-end. The structure of tRNA was confirmed by DNA sequencing of its gene.

MeSH terms

  • Base Sequence
  • DNA, Viral / genetics
  • Genes
  • Genes, Viral
  • Glutamine
  • Nucleic Acid Conformation
  • RNA, Transfer*
  • T-Phages / genetics*

Substances

  • DNA, Viral
  • Glutamine
  • RNA, Transfer

Associated data

  • GENBANK/X04177