Small molecules that interfere with DNA replication can trigger genomic instability, which makes these molecules valuable in the search for anticancer drugs. Thus, interactions between DNA and its ligands at the molecular level are of great significance. In the present study, a new method based on surface-enhanced Raman spectroscopy (SERS) combined with molecular dynamics simulations has been proposed for analyzing the interactions between DNA and its ligands. The SERS signals of DNA hairpins (ST: d(CGACCAACGTGTCGCCTGGTCG), AP1: d(CGCACAACGTGTCGCCTGTGCG)), pure argininamide, and their complexes, were obtained, and the characteristic peak sites of the DNA secondary structure and argininamide ligand-binding region were analyzed. Molecular dynamics calculations predicted that argininamide binds to the 8C and 9G bases of AP1 via hydrogen bonding. Our method successfully detected the changes of SERS fingerprint peaks of hydrogen bonds and bases between argininamide and DNA hairpin bases, and their binding sites and action modes were consistent with the predicted results of the molecular dynamics simulations. This SERS technology combined with the molecular dynamics simulation detection platform provides a general analysis tool, with the advantage of effective, rapid, and sensitive detection. This platform can obtain sufficient molecular level conformational information to provide avenues for rapid drug screening and promote progress in several fields, including targeted drug design.