Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.
Keywords: convulsion; electroencephalogram; equine; seizure.