Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone

Endocrinology. 2006 Sep;147(9):4292-302. doi: 10.1210/en.2006-0116. Epub 2006 Jun 22.

Abstract

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

MeSH terms

  • Animals
  • Base Sequence
  • Carcinoma, Hepatocellular
  • Cell Line
  • Cell Line, Tumor
  • Chlorocebus aethiops
  • Down-Regulation / drug effects
  • Gene Deletion
  • Gene Expression Regulation / drug effects*
  • Humans
  • Kidney
  • Liver / chemistry
  • Liver Neoplasms
  • Male
  • Mice
  • Mice, Inbred C57BL
  • Molecular Sequence Data
  • Mutagenesis
  • Promoter Regions, Genetic / genetics
  • RNA, Messenger / analysis
  • Receptors, Thyroid Hormone / metabolism
  • Response Elements / genetics
  • Retinoid X Receptors / metabolism
  • Reverse Transcriptase Polymerase Chain Reaction
  • Sterol Regulatory Element Binding Protein 1 / genetics*
  • Transcription, Genetic / drug effects
  • Transfection
  • Triiodothyronine / pharmacology*

Substances

  • RNA, Messenger
  • Receptors, Thyroid Hormone
  • Retinoid X Receptors
  • Srebf1 protein, mouse
  • Sterol Regulatory Element Binding Protein 1
  • Triiodothyronine